SciELO - Scientific Electronic Library Online

 
vol.20 issue6Choice of contraceptive methods by women attending a public health clinicFactors related to use of medication during pregnancy in six Brazilian cities author indexsubject indexarticles search
Home Page  

Services on Demand

Article

Indicators

Related links

Share


Cadernos de Saúde Pública

Print version ISSN 0102-311X

Cad. Saúde Pública vol.20 n.6 Rio de Janeiro Nov./Dec. 2004

http://dx.doi.org/10.1590/S0102-311X2004000600017 

ARTIGO ARTICLE

 

Triagem de hemoglobinopatias em doadores de sangue de Caxias do Sul, Rio Grande do Sul, Brasil: prevalência em área de colonização italiana

 

Screening for hemoglobinopathies in blood donors from Caxias do Sul, Rio Grande do Sul, Brazil: prevalence in an Italian colony

 

 

Cristina Lucia Alberti Lisot; Lúcia Mariano da Rocha Silla

Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brasil

Endereço para correspondência

 

 


RESUMO

A alta prevalência de beta-talassemia em italianos e a participação dos mesmos na formação étnica da cidade de Caxias do Sul e arredores, Rio Grande do Sul, Brasil, conduziram-nos à investigação de hemoglobinopatias em uma amostra de 608 doadores de sangue do Hemocentro Regional de Caxias do Sul. Apesar da influência étnica, encontramos 1,81% de hemoglobinas anormais (0,16% Hb AC, 0,99%, Hb AS e 0,66% Hb AH), um padrão similar com o estudo do interior do Estado do Rio Grande do Sul para alterações qualitativas. Para as talassemias, as técnicas mais comuns, cruzadas com seqüenciamento de DNA, em nossas mãos, não foram capazes de esclarecer anormalidades quantitativas da hemoglobina. Esse resultado pode ser atribuído a alterações genéticas ainda não conhecidas, a limitações técnicas ou, mais simplesmente, à miscigenação.

Hemoglobinopatias; Doadores de Sangue; Eletroforese


ABSTRACT

The high prevalence of beta thalassemia among Italians and their participation in the ethnic formation of Caxias do Sul, Rio Grande do Sul State, Brazil, and neighboring cities prompted us to investigate hemoglobinopathies in 608 blood donors at the Caxias do Sul Regional Blood Center. Despite the ethnic influence, abnormal hemoglobin levels were found in only 1.81% of the donors (0.16% Hb AC, 0.99% Hb AS, and 0.66% Hb AH), similar to the levels observed in a study on qualitative disorders conducted in the rural area of Rio Grande do Sul. In our setting, the most commonly used screening tests for thalassemia, combined with DNA sequencing, were unable to detect quantitative hemoglobin synthesis disorders. This may be attributable to still-unknown genetic disorders, technical limitations, or simply to miscegenation.

Hemoglobinopathies; Blood Donors; Electrophoresis


 

 

Introdução

As hemoglobinopatias constituem um grupo de doenças hereditárias que se caracterizam por apresentarem distúrbios na síntese das cadeias polipeptídicas da hemoglobina, sejam qualitativos ou quantitativos 1. Sabe-se que as diferentes doenças da hemoglobina estão relacionadas com a etnia 2,3.

A contribuição da imigração européia para a formação da população do Sul do Brasil é considerável. Um grande fluxo migratório de italianos ocorreu no Estado do Rio Grande do Sul no final do século XIX, povoando, preferencialmente, Caxias do Sul e arredores. Os imigrantes eram, principalmente, provenientes de Piedmont, no Norte da Itália 4, onde a freqüência de indivíduos microcitêmicos ou carreadores de beta-talassemia pode atingir altas proporções, podendo variar de 0,40% a 20,00% 5. Na cidade de Porto Alegre, a investigação de beta-talassemia, entre derivados de europeus, mostrou uma freqüência de 1,10% de heterozigotos para essa condição, sendo que 62,00% desses indivíduos eram de origem italiana 6.

Com a miscigenação da população brasileira, a hemoglobina S deixou de ser restrita à população derivada de africanos, sendo encontrada também nos outros grupos étnicos 1, assim como as talassemias.

As hemoglobinopatias têm sido muito estudadas no Brasil quanto à distribuição e prevalência em diferentes regiões e grupos étnicos, valendo-se, para esse propósito, das mais variadas populações e técnicas analíticas 3,7,8,9, 10,11,12,13,14 e freqüentemente das de bancos de sangue 1,15,16,17,18,19,20,21,22. O fato de que são raros os estudos, no interior do Estado do Rio Grande do Sul, quanto à freqüência dessas desordens em doadores de sangue 17 e que o conhecimento dessas condições gera ações em prol da assistência a portadores são os principais argumentos dos autores e de vários outros pesquisadores 2,13,21,23,24,25,26 para a triagem populacional de hemoglobinopatias.

O presente trabalho é, portanto, um dos poucos realizados no interior do estado e o primeiro na região da serra e teve como principal objetivo investigar a prevalência de hemoglobinopatias em doadores de sangue na cidade gaúcha de Caxias do Sul.

 

Metodologia

Desenhou-se um estudo transversal para avaliar a prevalência de hemoglobinopatias em doadores de sangue do Hemocentro Regional de Caxias do Sul, no período de abril a dezembro de 2001. Esse hemocentro constitui o principal centro de doação de sangue do nordeste do Rio Grande do Sul. Recebe cerca de 12 mil doações por ano provenientes de Caxias do Sul, Antônio Prado, Flores da Cunha, Vacaria, Carlos Barbosa, Bento Gonçalves, Bom Jesus, Gramado, Canela, Nova Petrópolis, São Marcos, Cotiporã e Feliz.

Consideram-se elegíveis os doadores com mais de 50kg, com idade entre 18 e 60 anos, hemoglobina entre 13,0 e 17,0g/dl para homens e para as mulheres entre 12,0 e 16,0g/dl, além de aptos na triagem clínica.

A seleção dos participantes foi feita de maneira aleatória 27, uma vez por semana, sendo sorteado um dia na semana, e, nesse dia, um turno de doação. Todos os doadores aptos que se apresentaram nos dias e turnos sorteados foram convidados a participar.

Para o estudo, uma amostra adicional de sangue periférico em EDTA foi coletada de cada doador, perfazendo um total de 608 amostras.

Informações para caracterizar o doador foram obtidas do banco de dados eletrônico do Hemocentro Regional de Caxias do Sul. A classificação dos grupos étnicos em derivados de europeus, derivados de africanos, mistos, indígenas e orientais foi feita por três colaboradoras treinadas, levando em consideração a cor da pele, dos olhos, espessura dos lábios e características do cabelo 8.

Os índices hematimétricos (HCT, VCM, HCM, CHCM e RDW) e a dosagem de hemoglobina no sangue doado foram obtidos através de contador eletrônico de células Coulter®ACT-DIFF.

Na triagem inicial, foi realizada eletroforese em pH 8,6 com tampão tris-borato de hemolisado preparado com sangue total e saponina a 1,0%, aplicado sobre suporte de acetato de celulose. Após, foi realizada eletroforese com a finalidade quantitativa através da aplicação de 20µl de hemolisado obtido com água destilada e extraído com clorofórmio, sobre suporte de acetato de celulose, em pH 8,6 com tampão tris-borato. A quantificação de hemoglobina A2 foi realizada por eluição aquosa e leitura de absorbância em espectrofotômetro Analyser® a 410nm. Tanto eletroforeses, nas quais foram encontradas hemoglobinas variantes, quanto dosagens de Hb A2 superiores ao valor de referência que é de 3,50% foram repetidas em duplicata e confirmadas. Eletroforese ácida pH 6,2 em suporte de gel ágar-citrato foi realizada para confirmar frações hemoglobínicas diferentes de A, A2, F e H.

Para as amostras com dosagem de Hb A2 superior a 3,50%, foi realizado, após extração, quantificação e amplificação de DNA, seqüenciamento do gene da beta globina da posição -20 até a +270, em seqüenciador MegaBACE®, com primers 5'GGCAGAGCCATCTATTGCTT3' e 5'GTTATGGGCAACCCTAAGGT3'.

Análise estatística

Os resultados foram analisados através de estatísticas descritivas utilizando a distribuição de freqüências e o teste exato de Fisher, usando o Statistcal Package for Social Science (versão 10.0) e Epi Info (versão 6.04B).

Considerações éticas

As Comissões Científica e Comissão de Pesquisa e Ética em Saúde, que é reconhecida pela Comissão Nacional de Ética em Pesquisa (CONEP) como Comitê de Ética em Pesquisa do Hospital de Clínicas de Porto Alegre (HCPA), aprovaram o estudo sob número 00.029, por estar adequado ética e metodologicamente de acordo com as Diretrizes e Normas Regulamentadoras de Pesquisa envolvendo Seres Humanos (Resolução 196/96 do Conselho Nacional de Saúde) e com as Resoluções Normativas do Grupo de Pesquisa e Pós-Graduação do HCPA. Foi obtido o consentimento livre e esclarecido de todos os participantes.

 

Resultados

Aproximadamente, 9 mil pessoas doaram sangue entre abril e dezembro de 2001. Dentre essas, 864 foram randomicamente sorteadas, e 70,40% aceitaram participar do estudo.

Destaca-se, na Tabela 1, que a maior parte dos doadores eram homens (62,00%), com primeiro grau incompleto (31,90%), naturais de Caxias do Sul e de outras cidades de colonização italiana (75,80%) e, predominantemente, derivados de europeus (71,90%).

 

 

Os índices hematimétricos para a população estudada foram normais (Tabela 2).

 

 

A média dos níveis de hematócrito e da concentração de hemoglobina foi de 44,00% e 15,0g/dl para os indivíduos do sexo masculino e 38,50% e 13,0g/dl para o feminino. A porcentagem de hemoglobina A2 foi analisada em 607 amostras, já que existiu uma heterozigose para hemoglobina C, o que impossibilitou a dosagem de A2 por eluição, pois Hb A2 e C migram na mesma posição em acetato de celulose.

Na população do estudo, foram encontrados 71 (11,68%) indivíduos afetados, desses, 1 (0,16%) tinha HbAC, 4 (0,66%) com possível alfa talassemia por apresentarem padrão eletroforético Hb AH, 6 (0,99%) com Hb AS, e 60 (9,87%) que sugeriam beta-talassemia por apresentarem Hb A2 acima do valor de referência para a técnica utilizada. Na Tabela 3, podemos ver a distribuição dos diferentes padrões eletroforéticos de acordo com o grupo étnico.

 

 

O VCM, CHCM e RDW dos 60 indivíduos com níveis de Hb A2 aumentados foram 91,3fl (±4,68), 33,5g/dl (±1,35) e 12,80% (±0,82), respectivamente. Cem por cento desses eram derivados de europeus ou mistos (Tabela 4). No entanto, nesse grupo, o seqüenciamento do gene da beta globina da posição -20 até a +270 não mostrou qualquer anormalidade.

 

 

Discussão

Os dados obtidos pela eletroforese de hemoglobina e dosagem de Hb A2 sugerem que cerca de 12,00% dos doadores de sangue do Hemocentro Regional de Caxias do Sul são portadores assintomáticos de hemoglobinopatias. Desses, 60 (9,87%) seriam portadores do traço beta-talassêmico e foram classificados como indivíduos derivados de europeus e mistos; 6 (0,99%) apresentaram Hb AS com aproximadamente 67,00% desses no grupo étnico derivado de europeus; 4 (0,66%) derivados de europeus e mistos com possível alfa talassemia e 1 (0,16%) misto heterozigoto para Hb C (Hb AC).

A ausência de alterações no segmento do gene para a beta globina estudado, no entanto, reduz para 1,81% ou 11 doadores portadores assintomáticos de hemoglobinopatias, dos quais, 4 (0,66%) com possível alfa talassemia, e 7 (1,15%) portadores de genes para hemoglobinopatias qualitativas. Esses resultados descrevem uma população de doadores de sangue em Caxias do Sul com dados compatíveis aos encontrados por Marcks et al. 17 em Santa Maria.

No estudo feito por Melo et al. 18 em 23.981 doadores de sangue de Uberlândia, Minas Gerais, e cidades subjacentes, os autores encontraram 820 (3,42%) portadores de hemoglobinopatias, distribuídas entre os seguintes tipos: Hb AS (2,48%), Hb AC (0,73%), beta-talassemia menor (0,13%), Hb AD (0,05%) e outros tipos (0,03%). No Rio Grande do Norte, foram estudados 630 doadores do Núcleo de Hematologia e Hemoterapia da Universidade Federal do Rio Grande do Norte, e os autores encontraram 15 (2,38%) indivíduos com hemoglobinas anormais; a prevalência do traço falciforme foi de 2,22% na amostra analisada como um todo e de 2,72% entre os indivíduos negróides, enquanto o genótipo AC foi detectado apenas em um indivíduo, dando uma prevalência em torno de 0,16% 1. No estudo desenvolvido no Laboratório de Hemoglobinas, Universidade Estadual de São Paulo, de São José do Rio Preto, São Paulo, por Orlando et al. 19, das 262 amostras testadas em doadores de sangue, 13 (4,96%) apresentaram hemoglobinas anormais, dentre os quais, 2 (0,76%) com HbAS, 3 (1,14%) com Hb AC, 5 (1,90%) com suspeita de alfa talassemia, 1 (0,38%) com suspeita de beta-talassemia e 2 (0,76%) com outros tipos de hemoglobinas. A heterogeneidade étnica da população brasileira, além de variações técnicas, impede a comparação dos resultados. No entanto, a Hb S está presente e foi a mais freqüente hemoglobinopatia identificada nesse e em outros estudos 9,13,15,19. Existe, naturalmente, uma relação com o contingente de africanos que povoaram as diversas regiões. A partir das regiões litorâneas, do Sudeste do país para o Norte, há um aumento na prevalência de Hb S. Por outro lado, em São José do Rio Preto, a prevalência do gene S parece ser da mesma ordem de grandeza que a encontrada em Caxias do Sul (0,76 e 0,99%, respectivamente) 19. São Paulo foi o outro Estado da Federação que recebeu imigrantes italianos 2,4. Em 262 doadores de sangue, o traço talassêmico alfa e beta estavam presentes em 1,90 e 0,38%, respectivamente 19, embora esse estudo não tenha sido complementado por investigação molecular.

Sabe-se que os carreadores heterozigotos (estigma beta-talassêmico) são clinicamente assintomáticos. Qualquer valor de hemoglobina A2 entre 3,50% e 8,00% é considerado como indicativo de beta-talassemia 28.

Inúmeros estudos apontam que valores de dosagem de Hb A2 aumentados podem ser usados como meio de triagem para beta-talassemia, e que a presença de valores limítrofes tanto para os índices hematimétricos bem como os valores normais de Hb A2 não excluem a presença dessa doença 29,30,31,32,33. Por outro lado, elevação nos níveis de hemoglobina A2, a característica típica da beta-talassemia, pode estar modificada em várias situações adquiridas e congênitas 30. Níveis temporariamente elevados dessa hemoglobina já foram descritos em situações de hipertireoidismo, anemia megaloblástica ou malária 30,34.

O fato de não termos encontrado alterações no segmento estudado do gene da beta globina dá margem para a especulação de limitação técnica na dosagem de Hb A2 35,36. Milone et al. 37 compararam técnicas de dosagem de Hb A2 e demonstraram que, para a técnica de quantificação por eluição, num total de 46 amostras normais, 6 foram falso-positivas. Com base nesses dados, deveríamos esperar encontrar 79 amostras falso-positivas para a população desse estudo, o que não é estatisticamente diferente das 60 amostras com Hb A2 maior que 3,50% encontradas. Se admitirmos essa hipótese, admitimos uma miscigenação maior do que a suspeitada inicialmente para uma região de colonização italiana.

Entretanto, não podemos desconsiderar a possibilidade de haver alterações na porção do gene não seqüenciada, além de alguma variação no DNA referente ao gene da delta globina que poderia supra-regular a síntese destas cadeias 30. Os achados no estudo italiano de Gasperini et al. 30 demonstraram a existência de um traço genético que se manifesta por isolado aumento de Hb A2 e ausência de lesões no gene da beta globina, que foi seqüenciado da posição -620 a +1.630. Os autores não comunicaram explicação clara para tal achado, porém postulam a presença de um defeito em algum lugar no genoma 30,38.

Estudos mais aprofundados são necessários para resolver essa questão. Por hora, resta a indagação do real significado da elevação de Hb A2 para o diagnóstico da beta-talassemia.

A baixa prevalência de alfa-talassemia se justifica (a) pela presumível composição étnica de origem européia dos doadores e (b) por subestimativa de hemoglobina H devido a bandas tão tênues que não permitem identificação visual na eletroforese.

Um dos grandes fatores limitantes desse estudo para encontrar traço beta-talassêmico típico (hematócrito normal, VCM diminuído e Hb A2 aumentada) parece ter sido o tamanho amostral, além de a seleção de doadores aptos naturalmente excluir indivíduos anêmicos.

Para finalizar, é curioso, mas não surpreendente nos dias de hoje, que a presença do traço falcêmico se fez também nos indivíduos classificados como derivados de europeus. Existem muitos fatores que influenciaram o fluxo gênico de caucasóide para negróides e vice-versa 39,40. Entre eles, Salzano et al. 39 citam (a) a incidência de grupos étnicos em regiões de contato, (b) cruzamento ao acaso, (c) fertilidade e mortalidade do híbrido/não-híbrido 39. Fato indiscutível é que a população brasileira está "branqueando", resultado da miscigenação e dos vieses na categorização da cor da pele. Depois de ter constituído, no princípio do século XIX, uma minoria (apenas 25,00%), os "brancos" constituem, hoje, a maioria 41.

Os resultados desse estudo permitem concluir que a população de doadores de sangue em Caxias do Sul é similar, em termos de alterações qualitativas, a outras populações do interior do estado, independente da etnia. Quando abordada a presença de alterações quantitativas, as técnicas empregadas não foram capazes de esclarecer a presença ou ausência de traços dessas patologias.

 

Colaboradores

L. M. R. Silla é responsável pontualmente pela reflexão comparativa entre nossos resultados e outros resultados encontrados no Brasil (parágrafo 3º da discussão); e, em sua totalidade, pela análise e anuência. De acordo, ambas as autoras assumimos responsabilidade e autoria do artigo.

 

Agradecimentos

Os autores agradecem a Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo/Fundação Hemocentro de Ribeirão Preto/Centro de Terapia Celular nas pessoas dos doutores Marco Zago e Wilson Araújo da Silva Júnior e dos acadêmicos Beatriz Paixão e Marcus dos Passos.

 

Referências

1. Bezerra TM, Andrade SR. Investigação sobre a prevalência de hemoglobinas anormais entre doadores de sangue. Rev Bras Anal Clin 1991; 23:117-8.        [ Links ]

2. Zago MA. Hemoglobinopatias: prevalência e variabilidade. Rev Paul Med 1986; 104:300-4.        [ Links ]

3. Tondo CV, Salzano FM. Abnormal hemoglobins in a brazilian negro population. Am J Human Genet 1962; 14:401-9.        [ Links ]

4 Frosi VM, Mioranza C. Inícios da imigração: processos de estabelecimento. In: Frosi VM, Mioranza C, organizadores. Imigração italiana no nordeste do Rio Grande do Sul. Porto Alegre: Universidade de Caxias do Sul/Instituto Superior Brasileiro Italiano de Estudos e Pesquisas; 1975. p. 38-42.        [ Links ]

5. Tentori L, Marinucci M, Massa A, Giugliani A, Mavilio F. Le emoglobinopatie in Italia: Distribuzione Geografica e Criteri per lo Screening. Recenti Prog Med 1981; 71:148-69.        [ Links ]

6. Freitas EM, Rocha FJ. Detection of beta-thalassemia heterozygotes among caucasians from Porto Alegre, RS, Brazil. Rev Bras Genet 1983; 6: 185-8.        [ Links ]

7. Bandeira FMGC, Leal MC, Souza RR, Furtado VC, Gomes YM, Marques NM. Características de recém-nascidos portadores de hemoglobina S detectada através de triagem em sangue de cordão umbilical. J Pediatr (Rio J) 1999; 75:167-71.        [ Links ]

8. Daudt LE, Zechmaister D, Portal L, Camargo Neto E, Silla LMR, Giugliani R. Triagem neonatal para hemoglobinopatias: um estudo piloto em Porto Alegre, Rio Grande do Sul, Brasil. Cad Saúde Pública 2002; 18:833-41.        [ Links ]

9. Ducatti RP, Teixeira AEA,; Galâo HÁ, Bonini-Domingos CR, Fett-Conte AC. Investigação de hemoglobinopatias em sangue de cordão umbilical de recém-nascidos do Hospital de Base de São José do Rio Preto. Rev Bras Hematol Hemoter 2001; 23:23-9.        [ Links ]

10. Ginabreda MGP, Sá E, Fonseca AA. Anemia falciforme e triagem neonatal. Rev Bras Hematol Hemoter 2000; 22 Suppl:22.        [ Links ]

11. Leonelli GG, Canalli AA, Bonini-Domingos CR. Caracterização de hemoglobina G em família residente no interior do Estado de São Paulo. Rev Bras Hematol Hemoter 2000; 22 Suppl:22.        [ Links ]

12. Pedrollo E, Hutz MH, Salzano FM. Alpha-thalassemia frequency in newborn children from Porto Alegre, Brazil. Rev Bras Genet 1990; 13:573-81.        [ Links ]

13. Viana-Baracioli LMS, Bonini-Domingos CR, Pagliusi RA, Naoum PC. Prevenção de hemoglobinopatias a partir de estudo em gestantes. Rev Bras Hematol Hemoter 2001; 23:31-9.        [ Links ]

14. Wagner SC. Identificação de talassemia alfa e outras hemoglobinopatias no Hospital de Clínicas de Porto Alegre [Dissertação de Mestrado]. Porto Alegre: Faculdade de Medicina, Universidade Federal do Rio Grande do Sul; 2002.        [ Links ]

15. Carvalho MG, Souza MO, Silva MBS, Oliveira JMC, Cardoso ICRA, Carvalho IP, et al. Hemoglobinas anormais: perfil estatístico em doadores de sangue do Centro de Hematologia e Hemoterapia de Minas Gerais. Rev Bras Anal Clin 1994; 26:39-40.        [ Links ]

16. Fabritius H, Millan J, Le Corroller Y. Results of 3 years of screening of abnormal hemoglobins in the blood donors of Guadeloupe (French Antilles). Bull Soc Pathol Exot Filiales 1978; 71:216-20.        [ Links ]

17. Marcks L, Zimmermann AP, Farias I, Buzatti E. Estudo da prevalência de hemoglobinopatias em doadores do banco de sangue do Hospital Universitário de Santa Maria. Rev Cient AMECS 1995; 4:31-4.        [ Links ]

18. Melo SMA, Arantes SCF, Botelho Filho A, Rocha AFS. Prevalência de Hemoglobinopatias em Doadores de Sangue do Hemocentro Regional de Uberlândia – MG. Rev Bras Hematol Hemoter 2000; 22 Suppl:51.        [ Links ]

19. Orlando GM, Naoum PC, Siqueira FAM, Bonini-Domingos CR. Diagnóstico diferencial de hemoglobinopatias em populações diferenciadas. Rev Bras Hematol Hemoter 2000; 22:111-21.        [ Links ]

20. Prudêncio BCAB, Covas DT, Bonini-Domingos CR. Comparação de metodologia utilizada para a detecção de hemoglobina S (Hb S) em doadores de sangue. Rev Bras Hematol Hemoter 2000; 22: 99-109.        [ Links ]

21. Ramalho AS. Hemoglobina S em doadores de sangue brasileiros. AMB Revista da Associação Médica Brasileira 1976; 22:467-8.        [ Links ]

22. Tavares Neto J, Bernardes R. Hemoglobinas anormais em doadores de sangue de Sobradinho (Distrito Federal, Brasil). Rev Bras Anal Clin 1980; 12:55-60.        [ Links ]

23. Angastiniotis M, Modell B. Global epidemiology of hemoglobin disorders. Ann N Y Acad Sci 1998; 850:51-69.        [ Links ]

24. Compri MB, Polimeno NC, Stella MB, Ramalho AS. Programa comunitário de hemoglobinopatias hereditárias em população estudantil brasileira. Rev Saúde Pública 1996; 30:187-95.        [ Links ]

25. Fleury MK, Lima JCS. Resultados de um programa preventivo para hemoglobinopatias na cidade do Rio de Janeiro. Revista Brasileira de Patologia Clínica 1989; 25:42-6.        [ Links ]

26. Ramalho AS, Silva RBP, Teixeira RC, Compri MB. Hemoglobin screening: response of a Brazilian community to optional programs. Cad Saúde Pública 1999; 15:591-5.        [ Links ]

27. Fletcher RH, Fletcher SW, Wagner EH. Freqüência. In: Fletcher RH, Fletcher SW, Wagner EH, organizadores. Epidemiologia clínica: elementos essenciais. Porto Alegre: Artes Médicas; 1996. p. 84-102.        [ Links ]

28. Rocha HHG. Estudo comparativo de duas metodologias para determinação da hemoglobina A2. Rev Bras Hematol Hemoter 1999; 21:89-90.        [ Links ]

29. Fortova H, Slavikova V, Musil F, Suttnar J, Brabec V. Diagnosis of beta-thalassemia on the basis of Hb A2 determination. Vnitr Lek 1995; 41:302-6.        [ Links ]

30. Gasperini D, Cao A, Paderi L, Barella S, Paglietti E, Perseu L, et al. Normal individuals with high Hb A2 levels. Br J Haematol 1993; 84:166-8.        [ Links ]

31. Madan N, Sikka M, Sharma S, Rusia U. Haematological parameters and Hb A2 levels in beta-thalassemia trait with coincident iron deficency. Indian J Pathol Microbiol 1998; 41:309-13.        [ Links ]

32. Metaxotou-Mavromati A, Kattamis C, Matathia L, Tzetis M, Kanavakis E. Clinical haematological and genetic studies of type 2 normal Hb A2 beta thalassemia. J Med Genet 1988; 25:195-9.        [ Links ]

33. Rosatelli MC, Pischedda A, Meloni A, Saba L, Pomo A, Travi M, et al. Homozygous beta-thalassemia resulting in the beta-thalassemia carrier state phenotype. Br J Haematol 1994; 88:562-5.        [ Links ]

34. Willcox M, Brohult J, Sirleaf V, Bengtsson E. Malaria and haemoglobin A2 levels in northern Liberia. Trans R Soc Trop Med Hyg 1979; 73:209-11.        [ Links ]

35. The laboratory diagnosis of haemoglobinopathies. Br J Haematol 1998; 101:783-92.        [ Links ]

36. Marengo-Rowe AJ. Rapid electrophoresis and quantitation os haemoglobins on cellulose acetate. J Clin Pathol 1965; 18:790-2.        [ Links ]

37. Milone G, Calaciura A, Granata P, Sortino G. HbA2 evaluation: comparison between microchromatography on DEAE cellulose column and conventional acetate electrophoresis. Boll Soc Ital Biol Sper 1981; 57:1777-82.        [ Links ]

38. Gallanello R, Barella S, Ideo A, Gasperini D, Rosatelli C, Paderi L, et al. Genotype of subjects with bordeline hemoglobin A2 levels: Implication for beta-thalassemia carrier screening. Am J Hematol 1994; 46:79-81.        [ Links ]

39. Salzano FM, Rocha FJ, Tondo CV. Hemoglobin types and gene flow in Porto Alegre, Brazil. Acta Genetica Stat Med 1968; 18:449-57.        [ Links ]

40. Sonati MF, Kaeda J, Kimura EM, Costa FF, Luzzatto L. Mild clinical expression of S-b thalassemia in a Brazilian patient with the b+ IVS-I-6 (TÆC) mutation. Genet Mol Biol [online] 1998; 21(4). http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1415- 47571998000400002&lng=en&nrm+isso.        [ Links ]

41. Lembert J. Estrutura étnica e contatos de raças. In: Lembert J, organizador. Os dois Brasis. São Paulo: Companhia Editora Nacional; 1984. p. 85-100.        [ Links ]

 

 

Endereço para correspondência
C. L. A. Lisot
Serviço de Hematologia e Transplante de Medula Óssea, Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul
Rua Eça de Queiróz 639, apto. 203
Porto Alegre, RS 90570-020, Brasil
crisliz@hotmail.com

Recebido em 25/Nov/2003
Versão final reapresentada em 21/Mai/2004
Aprovado em 24/Jun/2004