SciELO - Scientific Electronic Library Online

vol.10 issue1A profile of workers' health in an olefins plant in the Venezuelan state of ZuliaType 2 diabetes and depression in Guadalajara , Mexico , 2005 author indexsubject indexarticles search
Home Page  

Services on Demand




Related links


Revista de Salud Pública

Print version ISSN 0124-0064

Rev. salud pública vol.10 n.1 Bogotá Jan./Feb. 2008 

Artículos Originales/Original Articles


Epidemiología Molecular de la Tuberculosis en Bogotá en Aislados Clínicos
obtenidos durante 11 Años


Molecular epidemiology of tuberculosis in Bogotá in clinical isolates obtained over an 11-year period


Johana E. Hernández, Martha I. Murcia y Fernando de la Hoz

Departamento de Microbiología-Departamento de Salud Pública, Facultad de Medicina, Universidad Nacional de Colombia.,,,



Objetivo Tipificar molecularmente aislados clínicos de Mycobacterium tuberculosis obtenidas en Bogotá entre los años 1995 a 2006, mediante la técnica RFLP-IS6110 para establecer las relaciones filogenéticas existentes entre ellos y determinar casos debidos a infección reciente (casos agrupados) Vs reactivaciones endógenas (patrones únicos).
Métodos Se realizó un estudio retrospectivo, en el que se incluyeron 137 aislados clínicos pertenecientes al complejo Mycobacterium tuberculosis, obtenidos en Bogotá entre los años 1995 a 2006. Las variables estudiadas para cada paciente fueron: sexo, edad, confección con el Virus de la Inmunodeficiencia Humana, habitante en situación de calle, resultado de la baciloscopia, fecha del cultivo. Los aislados fueron identificados fenotípicamente y confirmados genotípicamente mediante el método molecular PRA y evaluados para sensibilidad a fármacos antituberculosos de primera línea utilizando el método simplificado de las proporciones múltiples. La genotipificación se realizó empleando el método de referencia RFLP-IS6110 (Polimorfismo en la Longitud de los Fragmentos de restricción).
Resultados Todos los aislados fueron confirmados como pertenecientes al complejo M. tuberculosis, mostrando la identificación fenotípica una concordancia del 100 % con la identificación genotípica. La monorresistencia encontrada fue de 9,4 %, y la MDR (resistencia a Rifampicina e Isoniazida) fue 2,9 %. La genotipificación se realizó a 129 aislados, de los cuales 96 (74 %) mostraron diferentes patrones RFLP-IS6110 y 35 aislados (26 %) estuvieron agrupados en 17 clusters conformados por 2 a 4 aislados. La relación epidemiológica entre los pacientes no pudo ser establecida en la mayoría de los casos. De las variables estudiadas solamente el estado de coinfección con VIH fue un predictor significativo para el agrupamiento (p<0.05).
Conclusión Los resultados de nuestro estudio muestran un alto porcentaje de genotipos con patrones RFLP-IS6110 únicos, lo que sugiere gran variabilidad genética entre los aislados de M. tuberculosis circulantes en Bogotá, indicando que la mayoría de los casos de tuberculosis en el estudio pueden ser atribuibles a reactivaciones endógenas.

Palabras Clave: Tuberculosis, transmisión, epidemiología molecular, dermatoglifia del ADN, polimorfismo de longitud del fragmento de restricción del ADN, tuberculosis farmacorresistente (fuente: DeCS, BIREME).


Objective Characterising clinical Mycobacterium tuberculosis isolates obtained from 1995 to 2006 in Bogotá, Colombia, using standardised IS6110-based RFLP typing for determining phylogenetic relationships. Calculating cases due to recent infection (grouped cases) cf endogenous reactivation (single patterns).
Methods This retrospective study characterised 137 clinical Mycobacterium tuberculosis isolates obtained in Bogotá from 1995 to 2006. Study variables consisted of gender, age, HIV status, homelessness, Ziehl Neelsen smear result and date of culture. All isolates were freshly identified by phenotypic methods, confirmed by PRA and evaluated for susceptibility to antimicrobial agents according to the proportional method. Mycobacterium tuberculosis cultures were typed by standardised IS6110-based RFLP.
Results All isolates were confirmed as being M. tuberculosis by phenotypic and genotypic methods. 9,4 % monoresistance and 2,9 % MDR (rifampicin- and isoniazid-resistant) were found. 129 M. tuberculosis isolates were genotyped; 96 (74 %) of them presented unique DNA fingerprints, whilst 35 (26 %) were grouped into 17 clusters consisting of two to four isolates. Direct epidemiological links between patients could not be established in most cases. Only HIV status was a significant predictor of clustering amongst the variables being studied (p<0.05). Conclusion The results of our study revealed a high proportion of unique DNA fingerprints, suggesting high genetic variability between M. tuberculosis strains in Bogotá, Colombia, meaning that most cases of TB in this study were attributed to endogenous reactivation.

Key Words: Tuberculosis, transmission, molecular epidemiology, DNA fingerprinting, restriction fragment length polymorphism, multidrug-resistant tuberculosis (source: MeSH, NLM).


La Tuberculosis (TB) continúa siendo un problema grave para la salud pública en el mundo, cada año aparecen 8,8 millones de nuevos casos y 1,7 millones de muertes (1). La tasa de incidencia de TB en Colombia para el 2005 fue de 20 por 100 mil (2). Bogotá, capital del país, para ese mismo año contó con una tasa de incidencia de 14,3 por 100 mil (2).

Con el avance de la biología molecular, diversas metodologías desarrolladas han permitido un mejor conocimiento de las micobacterias (3), es así como en la actualidad el método molecular PRA (PCR Restriction Analysis, Análisis de Restricción del Producto de la Reacción en Cadena de la Polimerasa) (4). Se emplea para su identificación a nivel inferior a especie y resulta más sencillo y rápido frente a los métodos convencionales que son laboriosos y demorados (3).

Así mismo, las técnicas moleculares basadas en la tipificación del ADN (Acido Desoxirribonucleico) han permitido un mejor entendimiento de la dinámica de transmisión de la tuberculosis y a la vez han contribuido para el mejoramiento de las estrategias de control (5,6). La metodología RFLP-IS6110 es la técnica de referencia para la genotipificación de Mycobacterium tuberculosis (M. tuberculosis) y fue estandarizada por Van Embden y col. (7). Este método está basado en las variaciones encontradas en el número de copias y localización en el genoma de la secuencia de inserción IS6110 que ocurren de una cepa a otra, patrones diferentes de RFLP-IS6110 sugieren cepas epidemiológicamente no relacionadas y patrones idénticos representan la transmisión reciente de la cepa dentro de la población (8).

El objetivo del presente estudio fue tipificar molecularmente aislados clínicos de M. tuberculosis obtenidas en Bogotá entre los años 1995 a 2006, mediante la técnica RFLP-IS6110 para establecer las relaciones filogenéticas existentes entre ellos y determinar la proporción de casos debidos a infección reciente (casos agrupados) Vs reactivaciones endógenas (patrones únicos). Se determinó la relación de agrupamiento con coinfección con el Virus de la Inmunodeficiencia Humana (VIH), estado de habitante en condición de calle y resistencia a los fármacos, entre otros.



Tipo de estudio El estudio realizado fue retrospectivo, descriptivo, utilizando los aislados de M. tuberculosis disponibles en el Laboratorio de Micobacterias del departamento de Microbiología de la Universidad Nacional y en la Secretaria Distrital de Salud. Se aclara que el diagnóstico de la TB en Colombia se basa en la Baciloscopia, por eso el bajo número de cultivos obtenidos.

Datos Demográficos Los datos demográficos de los pacientes fueron obtenidos de los formatos de registro de los laboratorios de salud pública de la Secretaria Distrital de Salud y del laboratorio de Micobacterias del departamento de Microbiología de la Universidad Nacional. Para cada paciente se incluyeron las variables: sexo, edad, tipo de tuberculosis, coinfección VIH, individuo en condición de calle y los datos microbiológicos: fecha del aislamiento, tipo de muestra y resultados para la tinción de Zielh Neelsen.

Aislados de M. tuberculosis Se estudiaron 137 aislados clínicos de M. tuberculosis provenientes de diferentes centros hospitalarios de la ciudad de Bogotá de 1995 a 2006, proporcionados por el laboratorio de Micobacterias del Departamento de Microbiología, Facultad de Medicina de la Universidad Nacional y el laboratorio de Salud pública de la Secretaria Distrital de Salud. Teniendo en cuenta el comportamiento estable de la tuberculosis en los últimos años para el período de estudio, se calculan aproximadamente 9900 casos diagnosticados en Bogotá (2), por consiguiente los aislados incluidos en este estudio representan el 1 % del total de casos.

La identificación fenotípica se realizó siguiendo la metodología propuesta por el CDC (9) y fue confirmada genotípicamente mediante el método molecular PRA, de acuerdo a la metodología estandarizada por Telenti y col. (4). La sensibilidad a los fármacos antituberculosos Isoniacida (0.2 µg/ml), Rifampicina (40.0 µg/ml), Estreptomicina (4.0 µg/ml) y Ethambutol (2.0 µg/ml), se determinó utilizando el método simplificado de las proporciones múltiples propuesto por Canetti y col (10).

Metodología PRA Este método se realizó de acuerdo con el procedimiento descrito por Telenti y col (4). Brevemente, un fragmento de 439 pb fue amplificado a partir del ADN extraído de los cultivos de M. tuberculosis, empleando los oligonucleótidos TB11 (5' ACCAACGATGGTGTGTCCAT) y TB12 (5' CTTGTCGAACCGCATACCCT), a continuación una digestión con las endonucleasas HaeIII y BstEII fue realizada siguiendo las recomendaciones del fabricante. Los productos digeridos fueron evaluados en un gel de agarosa de bajo punto de fusión al 3 %. La identificación se realizó determinando los tamaños de los fragmentos obtenidos tras la digestión, siguiendo algoritmos de referencia,

RFLP- IS6110 Esta metodología se realizó de acuerdo a la propuesta de estandarización de Van Embden y col (7). Brevemente los aislados fueron subcultivados en medio Lowenstein Jensen e incubados a 37 ºC durante 2 a 3 semanas para llevar a a

cabo la extracción del ADN de acuerdo a la metodología propuesta por Soolingen D (11), 4.5 µg/ml de ADN de cada aislado fue digerido con la endonucleasa PvuII y corrido electroforéticamente en un gel de agarosa al 0.8 %. Se realizó una transferencia por capilaridad a una membrana de Nylon (Amersham Pharmacia-Biotech). Se preparó una sonda de 245-pb de IS6110, obtenida a través de PCR, empleando los oligonucleotidos INS-1 (5' CGTGAGGGCATCGAGGTGGC),INS-2(5' GCGTAGGCGTCGGTGACAAA), la que fue marcada mediante quimioluminiscencia utilizando el estuche comercial ECL (direct nucleic acid labelling), siguiendo las recomendaciones del fabricante (Amersham Pharmacia-Biotech). La hibridación se realizó durante toda la noche a 42°C Los patrones de hibridación fueron visualizados con el estuche comercial ECL empleando películas fotosensibles (Amersham Pharmacia-Biotech).

Análisis Estadístico Se utilizo Excel 2003 para los análisis descriptivos de las variables incluidas en el estudio.

Análisis de los patrones RFLP Los patrones genotípicos obtenidos fueron analizados con el Software Gelcompar versión 4,6 (Applied Maths, Kortrijk, Belgium) y comparados empleando el método UPGMA y el coeficiente DICE. Se consideraron cepas agrupadas cuando mostraron genotipos con una similitud ³90 % (12) y cepas con patrones únicos cuando la similitud fue <90 %, en todos los casos estos estuvieron sujetos a evaluación visual. La comparación de cepas agrupados y no agrupados con las variables demográficas estudiadas se realizó a través de la prueba exacta de Fisher, utilizando el paquete estadístico Stata 8,0.



Todos los aislados de estudio fueron identificados fenotípica y genotípicamente como pertenecientes al complejo M. tuberculosis. En cuanto a la Pruebas de sensibilidad a Fármacos antituberculosos se encontró una monorresistencia global de 9,4 % y sus intervalos de confianza del 95 % (IC= 95 % 5,1 - 15,6), a Rifampicina de 3,6 % (IC 95 % 1,1 - 8,3), a Isoniacida 4,3 % (IC 95 % 1,6 - 9,2), a estreptomicina de 8 % (IC 95% 4 -13) y a Ethambutol de 1,4 % (IC 95 % 0,17 -5,1). La multidrogorresistencia (MDR) encontrada fue de 2,91 %. Las proporciones encontradas en este estudio se encuentran afectadas por las características de la población, debido a que no fue posible diferenciar entre pacientes previamente tratados y sin tratamiento. Aislados incluidos en el análisis a través de RFLP De los 137 aislados iniciales, un total de 129 aislamientos provenientes de 125 pacientes fueron estudiados a través de RFLP-IS6110, los restantes 8 aislados no fueron genotipificados debido a deficiencias en la calidad de su ADN.

Análisis de los patrones RFLP- IS6110 Un total de 94 aislados (73 %) mostraron patrones únicos para RFLP IS6110, lo cual sugiere su independencia epidemiológica (8). Mientras que 35 aislados (27 %) se encontraron agrupados en 17 clusters, constituidos por 2 a 4 aislados, representando posibles casos de transmisión reciente. El número de copias de IS6110 por aislado estuvo entre 5 a 25 copias de la secuencia de inserción; solo un aislado presento 5 copias.

La relación epidemiológica entre los pacientes agrupados no pudo ser establecida para la mayoría de los casos. Sin embargo, en tres clusters (números 5, 8 y 12) se encontró asociación entre los aislados en cuanto a fecha y centro hospitalario. Un hallazgo interesante del estudio fue el observado en el cluster número 4, en el cual un genotipo de M. tuberculosis aislado de un paciente infectado por VIH, permaneció durante 10 años, siendo recuperado de otro individuo VIH positivo. Finalmente el cluster número 13, estuvo conformado por 3 aislados obtenidos de la misma paciente, infectada también por VIH.

Aunque los datos obtenidos en este estudio obedecen a un análisis descriptivo, ellos parecen sugerir que la transmisión de la tuberculosis en Bogotá es atribuida principalmente a reactivaciones de infecciones adquiridas en el pasado y que posiblemente factores individuales son más importantes en la transmisión de la enfermedad.

Características de los pacientes Los pacientes estuvieron en un rango de edad de 2 a 82 años, con una media de 46,7 años y una desviación estándar de 18,3 años. La mayoría de los pacientes (35 %) estuvieron entre 30-44 años y 71 % pertenecieron al sexo masculino. El 77 % de los pacientes presentó formas pulmonares de la enfermedad y un 8,8 % estuvo coinfectado con VIH. Un 95 % de los pacientes presentó un resultado positivo para la baciloscopia y el 2,2 % correspondió a individuos en situación de calle.

Factores de Riesgo asociados a cepas agrupadas (transmisión reciente)

Los pacientes con cepas agrupadas fueron comparados con los pacientes infectados con cepas no agrupados, para identificar los posibles factores de riesgo de transmisión de tuberculosis. La edad, sexo, ser individuo en situación de calle, resistencia a fármacos y Baciloscopia positive no mostraron asociación estadísticamente significativa con el agrupamiento molecular (p>0.05). En contraste el estado de coinfección VIH-1 estuvo asociado al agrupamiento molecular (p<0.05). Sin embargo, el número de pacientes coinfectados con VIH en este estudio no es lo suficientemente representativo, se requieren hacer estudios con un mayor número de pacientes que permita confirmar este hallazgo (Tabla 1).




Este trabajo representa el primer acercamiento a la epidemiología molecular de la TB en Bogotá. El análisis de las 129 aislados estudiados mostró un 73 % de cepas con patrones únicos mientras que el 27 % de las cepas estaban agrupadas en clusters, proporción similar a la observada en otras áreas geográficas donde la incidencia de TB es baja (13). Este hallazgo sugiere que la transmisión de la TB en Bogotá puede atribuirse principalmente a reactivaciones endógenas de infecciones adquiridas en el pasado (8) y que las medidas de control de la enfermedad adoptadas en Bogotá han disminuido la transmisión reciente de individuos infectados a individuos susceptibles y que son los cambios en el estado inmunológico de los individuos infectados los que explicarían la mayoría de los casos. Los resultados representan un aporte importante de los métodos moleculares a la epidemiología y al control de la TB, el cual difícilmente podría lograrse sin apoyo de estos métodos. A pesar de ser Colombia un país donde la TB es endémica, no se han reportado brotes de fuente común, lo que refleja más una debilidad importante de la vigilancia, por no implementar el uso de métodos de epidemiología molecular como herramienta valiosa para evaluar los programas de control de la enfermedad.

Una de las debilidades potenciales del presente estudio es que la proporción de muestras analizadas representó solo el 1 % aproximadamente de todos los casos diagnosticados durante el mismo periodo en Bogotá, situación que refleja las debilidades en la vigilancia de la TB en el país, ya que el diagnóstico en la mayoría de los casos se hace mediante baciloscopia y solo muy ocasionalmente se realizan cultivos (14). Esto hace difícil la vigilancia continua de características biológicas de la micobacteria, como la resistencia y la aparición de brotes y conglomerados de la enfermedad. En las nuevas guías de manejo de TB se ha propuesto que todas las muestras que den baciloscopias positivas sean cultivadas, acción que permitirá tipar los aislados de M. tuberculosis circulantes y mejorar el entendimiento de la dinámica de transmisión de la TB en Bogotá.

Una fortaleza del estudio es que los aislados de M. tuberculosis estudiados provenían de instituciones tanto de la red pública como de la red privada por lo que los pacientes presentaron características epidemiológicas diferentes. En el análisis de los agrupamientos realizado para cada centro hospitalario, no se encontraron cepas en claustres, hallazgo que sustenta la conclusión anterior de que la transmisión desde personas infectadas no es tan importante en Bogotá.

Los resultados obtenidos en cuanto a resistencia a fármacos antituberculosos, no mostraron cambios estadísticamente significativos al ser comparados con los estudios de vigilancia a la resistencia realizados en Colombia (15) (datos no mostrados), a pesar de que en nuestro país solo se realizan las pruebas de sensibilidad cuando los pacientes presentan fallas en esquemas de tratamiento y retratamiento. A diferencia de otros estudios (16,17), el nuestro no encontró asociación estadísticamente significativa entre cepas agrupadas y resistencia a fármacos antituberculosos de primera línea, seguramente debido al bajo porcentaje de cepas resistentes estudiadas. Solamente 4 cepas resistentes (3,1 %) se encontraron formando parte de grupos de transmisión, aunque cada una de ellas formó parte de grupos diferentes. La situación de la resistencia parece no ofrecer un problema en la actualidad, sin embargo los autores creemos que el panorama podría cambiar, siendo necesario implementar un programa de vigilancia centinela que permita detectar rápidamente la circulación de cepas resistentes y MDR que impida su diseminación a nivel hospitalario o en la comunidad (18).

De las variantes epidemiológicas estudiadas solo la condición de coinfección VIH estuvo asociada al agrupamiento (transmisión reciente). Un estudio en Nueva York encontró asociación entre el estado de coinfección con VIH y agrupamiento o transmisión reciente, pacientes coinfectados con TB y VIH tiene alto riesgo de transmisión y enfermedad (6). Según reportes recientes, la prevalencia de VIH en Colombia se ha incrementado de manera importante, esto implica que también la carga de enfermedad de TB asociada a VIH podría estar incrementándose, por lo que a todo paciente VIH positivo debe estudiársele TB y micobacteriosis y a todo paciente con TB debe estudiársele infección VIH (19).

Grupos poblacionales como individuos en situación de calle han mostrado ser factores de riesgo para el agrupamiento (20,21). Bogotá como ciudad capital de Colombia se encuentra expuesta a los continuos movimientos poblacionales de diversas zonas del país, esta población desplazada muchas veces termina convirtiéndose en habitante en situación de calle, lo que puede agravar el control de la tuberculosis en la capital. A pesar de que el estudio no logró un buen acercamiento a la epidemiología de la TB en esta población especial, es primordial estudiarla debido al alto riesgo que representa como un foco efectivo e importante de transmisión y de difícil control.

En conclusión, en el presente estudio la variabilidad genética encontrada y reflejada en una alta proporción de genotipos de M. tuberculosis con patrones únicos, sugiere que en Bogotá la TB es debida más a reactivaciones endógenas de infecciones adquiridas en el pasado que a transmisiones recientes lo que sugiere que las acciones del programa de control en la ciudad, deben encaminarse al control de los individuos infectados. Nuestra principal recomendación es que se implemente rápidamente el cultivo de todas las muestras positivas para que este tipo de análisis pueda realizarse periódicamente y así apoyar los procesos de evaluación de la efectividad del programa de control de la TB. Deben plantearse estudios prospectivos en poblaciones de alto riesgo para TB que logren integrar herramientas de la epidemiología clásica y la biología molecular que permitan mejorar el entendimiento de la dinámica de transmisión de esta enfermedad en la capital ¨ Agradecimientos. A la Secretaría Distrital de Salud de Bogotá y a todos los centros hospitalarios de Bogotá que contribuyeron con aislamientos de M. tuberculosis. Este trabajo fue financiado por la División de Investigación de la Universidad Nacional de Colombia (código QUIPU número 8009000).



1. WHO Report. Global Tuberculosis Control, Surveillance, Planning, Financing. World Health Organization; 2006         [ Links ]

2. Ministerio de la Protección Social. Dirección general de Salud Pública. Instituto Nacional de Salud. Subdirección de Epidemiología y Laboratorio Nacional de Referencia. Informe quincenal Epidemiológico Nacional. 2006; 11 (6): 88-90.         [ Links ]

3. Murcia MI, Leao SC, Rittaco V, Palenque E, de Oliveira RS, Reniero A, et al. Distribución de patrones PRA en aislamientos clínicos del complejo Mycobacterium avium procedentes de España y Suramérica. Biomédica. 2004; 25: 22-33.         [ Links ]

4. Telenti A, Marchesi F, Balz M, Bally F, Bottger EC and Bodmer T. Rapid Identification of Mycobacteria to Species Level by Polymerase Chain Reaction and Restriction Enzyme Análisis. J. Clin. Microbiol. 1993;31: 175-178.         [ Links ]

5. Drobniewski F, Gibson A, Ruddy M. Evaluation and Utilization as a Public Health Tool of a National Molecular Epidemiological Tuberculosis Outbreak Database within the United Kingdom from 1997 to 2001. J Clin Microbiol. 2003; 41:1861-1868.         [ Links ]

6. Small P, Hopewell P, Singh P, Paz A, Parsonnet J, Ruston D, et al. The Epidemiology of Tuberculosis in San Francisco A Population-Based Study Using Conventional and Molecular Methods. N. Engl. J. Med. 1994; 330: 1703-1709.         [ Links ]

7. Van Embden J, Cave M, Crawford J, Dale J, Eisenach K, Gicquel B, et al. Strain Identification of Mycobacterium tuberculosis by DNA Fingerprinting: Recommendations for a Standarized Methodology. J Clin Microb. 1993; 31:406-409.         [ Links ]

8. Van Soolingen D, Hermans P, de Hass P, Soll D, Van Embden J. Ocurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculosis. J. Clin. Microbiol. 1991; 29: 2578-2586.         [ Links ]

9. Kent T, Kubica GP. Public Health Mycobacteriology. A guide for the level III laboratory. Atlanta: U.S. Department of Health, and Human Services, Centre for Disease Control; 1985. pp. 71-120.         [ Links ]

10. Canetti G, Rist N, Grosset J. Mesure de la sensibilité du bacille tuberculeux aux drogues antibacillaires pour le méthode des proportions. Rev Tuber (Paris). 1963; 27: 217-72.        [ Links ]

11. Van Soolingen D, De Hass P, Kremer K. Restriction Fragment Length Polymorphism (RFLP) typing of micobacteria. National Institute of Public Health and the Environment. Bilthoven, The Netherlands; 2002.         [ Links ]

12. Niemann S, Gerdes S, Ritcher E, Thielen H, Uden H, Diel R. Stability of IS6110 restriction fragment length polymorphism patterns of Mycobacterium tuberculosis strains in actual chains of transmission. J. Clin. Microbiol. 2000; 38: 2563-2567.         [ Links ]

13. Torrea G, Ofredo M, Simonet B, Gicquel P, Berche P, Audigier P. Evaluation of tuberculosis transmission in a community by 1 year of systematic typing of Mycobacterium tuberculosis clinical isolates. J. Clin. Microbiol. 1996; 34:1043-1049.         [ Links ]

14. Secretaria Distrital de Salud de Bogotá. Informe Reunión Nacional de Coordinadores de PCT. Colombia; 2006.         [ Links ]

15. Instituto Nacional de salud. Vigilancia de la resistencia de Mycobacterium tuberculosis a los medicamentos. Colombia 2004-2005; 2006         [ Links ]

16. Quitugua T, Seaworth B, Weis S, Taylor J, Guillete J, Rosas I, et al. Transmission of Drug-Resistat Tuberculosis in Texas and Mexico. J Clin Microbiol. 2002 ; 40:2716-2724.         [ Links ]

17. Gutierrez M, Vincent V, Bizet A, Gaillot O, Lebrun L, Pendeven C, et al. Molecular Fingerprinting of mycobacterium tuberculosis and Risk Factors for Tuberculosis Transmission in Paris, France, and Surrounding Area. J. Clin. Microbiol. 1998; 36: 486-492.         [ Links ]

18. Rivero A, Marquez M, Santos J, Pinedo A, Sanchez MA, Esteve A, et al. High rate of tuberculosis reinfection during a nosocomial outbreak of multidrug-resistant tuberculosis caused by Mycobacterium bovis strain B. Clin Infect Dis. 2001;32(1):159-61.         [ Links ]

19. Castiblanco C, Ribón W. Coinfección de tuberculosis en pacientes con VIH/SIDA: un análisis según las fuentes de información en Colombia. Infectio 2006; 10(4): 232-242.         [ Links ]

20. Mistry N, Iyer A, D'souza D, Taylor G, Young D, Antia N. Spoligotyping of Mycobacterium tuberculosis Isolates from Multiple-Drug-Resistant Tuberculosis Patients from Bombay, India. J Clin Microbil. 2002; 40: 2677-2680.         [ Links ]

21. Kempf M, Dunlap N, Lok K, Benjamin W, Keenan N, Kimberling M. Long-Term Molecular Analysis of Tuberculosis Strains in Alabama a State Characterized by a Largely Indigenous, Low-Risk Population. J. Clin. Microbiol. 2005; 43: 870-878.        [ Links ]