SciELO - Scientific Electronic Library Online

 
vol.28 issue4Clinical and polysomnographyc differences between obese and non obese patients with obstructive sleep apnea-hypopnea syndromeChildren hospitalized with influenza pneumonia AH1N1/2009 pandemic in the INSN author indexsubject indexarticles search
Home Page  

Revista Peruana de Medicina Experimental y Salud Pública

Print version ISSN 1726-4634

Rev Peru Med Exp Salud Publica vol.28 n.4 Lima Dec. 2011

http://dx.doi.org/10.1590/S1726-46342011000400005 

Artículo original

Infecciones del sistema nervioso central por enterovirus en niños atendidos en un hospital de Lima, Perú

Enteroviral central nervous system infections in children treated at a hospital in Lima, Peru

 

Iván O. Espinoza1,2,a , Theresa J. Ochoa1,3,4,b, Susan Mosquito1,c, Francesca Barletta1,d, Roger Hernández1,2,4,b, María del Pilar Medina1,5,a, María Luisa Stiglich1,6,a, Claudia Ugarte1,2,e, Daniel Guillén1,2,a

1 Universidad Peruana Cayetano Heredia. Lima, Perú.

2 Hospital Nacional Cayetano Heredia. Lima, Perú.

3 University of Texas School of Public Health, Houston. Texas, Estados Unidos de América.

4 Grupo Peruano de Investigación en Neumococo (GPIN). Lima, Perú.

5 Instituto Nacional Materno Perinatal. Lima, Perú.

6 Hospital Nacional Docente Madre Niño San Bartolomé. Lima, Perú.

a Médico neurólogo pediatra; b Médico infectólogo pediatra; c Microbiólogo; d Biólogo molecular; e Médico pediatra


RESUMEN

Objetivos. Determinar la frecuencia y las características clínicas de las infecciones del sistema nervioso central por enterovirus en niños atendidos en el Hospital Nacional Cayetano Heredia de Lima, Perú. Materiales y métodos. Se realizó un estudio prospectivo y descriptivo desde abril 2008 hasta marzo 2010. Se enrolaron pacientes de un mes a 14 años con diagnóstico clínico de encefalitis o meningitis asépticas. Se investigó la presencia de enterovirus, virus herpes simple 1 (VHS-1), virus herpes simple 2 (VHS-2) y virus varicela-zoster (VZV) mediante reacción en cadena de polimerasa (PCR). Resultados. Se enrolaron 97 pacientes de los cuales 69 % presentaron encefalitis aguda y 31 % meningitis aguda. Se identificó enterovirus en 52,6 % del total de infecciones agudas no bacterianas del sistema nervioso central; encontrándose en 83,3 % de las meningitis y en 38,8 % de las encefalitis. No hubo casos de infección por VHS-1, VHS-2 ni VZV. Las infecciones por enterovirus alcanzaron el 82,9 % en los meses cálidos de noviembre a enero y el 28,6 % en los meses fríos de mayo a julio. Conclusiones. Los enterovirus fueron los principales agentes etiológicos en las encefalitis y meningitis asépticas agudas en pacientes pediátricos de Lima, Perú. Los enterovirus tienen un comportamiento epidemiológico estacional con un claro aumento del número de casos en los meses de verano. Resulta útil tener disponible un método de diagnóstico rápido, como una ayuda para el manejo de las infecciones agudas del sistema nervioso.

Palabras clave: Enterovirus; Meningitis; Encefalitis; Reacción en cadena de la polimerasa; Encefalopatías; Crisis epilépticas; Niño (fuente: DeCS BIREME).


ABSTRACT

Objectives. To determine the frequency and clinical features of central nervous system infections caused by enterovirus in children treated at the Hospital Nacional Cayetano Heredia in Lima, Peru. Materials and methods. A prospective, descriptive study was performed from April 2008 to March 2010. Patients aged 1 month – 14 years with clinical diagnosis of encephalitis or aseptic meningitis were included. We investigated the presence of enterovirus, herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2) and varicella-zoster virus (VZV) by polymerase chain reaction (PCR). Results. 97 patients were included, out of which 69 % had acute encephalitis and 31 % acute meningitis. Enteroviruses were identified in 52,6% of all acute non-bacterial central nervous system infections; corresponding to 83,3 % of meningitis and 38,8 % of encephalitis. There were no cases of infection due to HSV-1, HSV-2 or VZV. Enterovirus infections reached 82,9 % in the warm months (November-January) and 28,6 % in the colder months (May-July). Conclusions. Enteroviruses are the principal etiologic agents in acute aseptic meningitis and encephalitis in pediatric patients in Lima, Peru. Enteroviruses have a seasonal epidemiological pattern with a clear increase in the number of cases during the summer months. It is useful to have this rapid diagnostic method available as an aid in the management of acute central nervous system infections.

Key words: Enterovirus; Meningitis; Encephalitis; Polymerase chain reaction; Brain diseases; Epilepsy; Child (source: MeSH NLM).


INTRODUCCIÓN

Las infecciones virales del sistema nervioso central (SNC) son más frecuentes que las infecciones bacterianas (1,2). En los últimos años esta diferencia se ha acentuado debido a las crecientes coberturas de inmunización contra Haemophilus influenzae tipo b y Streptococcus pneumoniae (3-5). Los enterovirus representan en muchos países la principal causa de infecciones agudas del SNC en porcentajes que varían entre el 24 y el 95 % según el área geográfica (1,2,6-8) y, usualmente, tienen una presentación epidémica y estacional al igual que los arbovirus y los virus respiratorios (9).

La mortalidad y la morbilidad, a largo plazo, de las infecciones virales del SNC, dependen de la edad del paciente, su estado inmunológico, la virulencia del agente y la seriedad del cuadro (10). Generalmente, la evolución es benigna; sin embargo, las infecciones por virus herpes simple (VHS), la encefalitis equina venezolana, el virus de la rabia y algunos enterovirus, pueden ocasionar la muerte o secuelas a largo plazo como trastornos del lenguaje, memoria, aprendizaje y conducta, epilepsia, parálisis cerebral, desórdenes del movimiento y retardo mental. Estas entidades representan una importante carga económica y social para las familias, la sociedad y los sistemas de salud (10,11).

La reacción en cadena de polimerasa (PCR) es el método diagnóstico de elección por su alta sensibilidad y especificidad, no obstante, en países en desarrollo no se usa en forma rutinaria. Las pruebas inmunológicas y los cultivos virales son pruebas poco sensibles y de resultados tardíos, por lo que no son útiles para decidir el uso o no de antibióticos o antivirales al momento del ingreso del paciente (9,12,13).

Desde el punto de vista de salud pública es muy importante determinar el comportamiento epidemiológico de las infecciones virales del SNC. A nivel individual, precisar la etiología de la infección neurológica sirve para la toma de decisiones con respecto al tratamiento, prevención y profilaxis adecuadas. Contribuye a establecer de mejor manera el pronóstico y puede evitar el uso de antibióticos, antivirales, exámenes auxiliares, procedimientos y estancias hospitalarias prolongadas innecesarias (1,14).

En el Perú no se cuenta con estudios epidemiológicos de las infecciones virales del SNC en niños y los datos provenientes de otros países difieren mucho en sus resultados y no necesariamente pueden extrapolarse a nuestra realidad epidemiológica. Por este motivo, se desarrolló el presente estudio con la finalidad de determinar la frecuencia y las características clínicas de las infecciones agudas del SNC por enterovirus detectados por la técnica de PCR en líquido cefalorraquídeo (LCR), en niños de un mes a 14 años de edad, atendidos en el Hospital Nacional Cayetano Heredia (HNCH) de Lima, Perú.

MATERIALES Y MÉTODOS

PACIENTES

El presente trabajo es una investigación prospectiva y descriptiva. Se realizó una vigilancia activa y diaria que inicialmente identificaba a todos los pacientes con sospecha de infección aguda del SNC de cualquier etiología. Ingresaron al estudio todos los pacientes con síntomas y signos sugerentes de infección aguda del SNC que acudieron al HNCH entre el 1 de abril de 2008 al 31 de marzo de 2010 y que cumplieron los siguientes criterios de inclusión: 1) edad comprendida entre 1 mes y 14 años; 2) tiempo de enfermedad menor o igual a siete días; 3) diagnóstico clínico de infección aguda del SNC y 4) muestra de LCR de por lo menos un mililitro obtenida por una punción lumbar no traumática. Se excluyeron a los pacientes con: 1) infección bacteriana o tuberculosa del SNC demostrada por coloración de Gram, coloración Ziehl-Neelsen, coaglutinaciones o cultivo de LCR; 2) encefalopatía atribuible a eventos metabólicos, tóxicos o hidroelectrolíticos; 3) portadores de sistemas de derivación de LCR o 4) infección del SNC secundaria a traumatismos craneoencefálicos o procedimientos neuroquirúrgicos.

Se estableció el diagnóstico clínico de encefalitis en los pacientes con alteración del nivel de conciencia, disfunción cognitiva, cambios conductuales, anormalidades neurológicas focales o crisis epilépticas, sin hallazgos de laboratorio que sugieran irritación meníngea (recuento leucocitario en LCR ≤ 10 cel/mm3).

El diagnóstico clínico de meningitis se determinó por la presencia de pleocitosis (recuento leucocitario en LCR > 10 cel/mm3) con o sin rigidez de nuca, signos meníngeos o disfunción encefálica.

Los pacientes que cumplieron los criterios de selección recibieron la atención médica rutinaria en los servicios de Emergencia Pediátrica, Unidad de Cuidados Intensivos y Hospitalización de Pediatría. El grupo investigador en coordinación con los médicos tratantes, pidió la autorización a los familiares para la realización de las pruebas de PCR en el LCR y la recolección de datos demográficos, clínicos y de laboratorio de los niños incluidos.

ANÁLISIS DE LABORATORIO

En las muestras de LCR se investigó la presencia de enterovirus, VHS-1, VHS-2 y virus varicela zoster (VZV) mediante PCR. Estos estudios se realizaron en el Laboratorio de Biología Molecular del Instituto de Medicina Tropical (IMT) “Alexander Von Humboldt” de la Universidad Peruana Cayetano Heredia. Se guardó una muestra de LCR en refrigeración a -70 °C en el criobanco del IMT.

Para la extracción de ácidos nucleicos se utilizó el High Pure Viral Nucleic Acid Kit (Roche Diagnostics®, Alemania) para la extracción y purificación del ADN viral (herpesvirus) y ARN viral (enterovirus). A partir de 200 μL de LCR se obtuvieron 50 μL de ácidos nucleicos virales, los cuales fueron almacenados a -70 °C hasta su posterior análisis. La síntesis de cDNA se realizó con el Transcriptor First Strand cDNA Síntesis Kit (Roche Diagnostics®, Alemania). A partir de 7 μL de ARN se obtuvieron 20 μL de cDNA. El cDNA se almacenó a -20 °C hasta su posterior análisis.

Para la detección de HSV-1, HSV-2 y VZV a partir del ADN viral extraído, se utilizó un PCR a tiempo real usando el Lightcycler HSV 1/2 Detection Kit (Roche Diagnostics®, Alemania) el cual incluye controles positivos y negativos.

Para la detección de enterovirus se utilizó un PCR convencional, utilizando los primers o cebadores (Forward 5´-3 CGGCCCCTGAATGCGGCTAA y Reverse GAAACACGGACACCCAAAGT) previamente descritos y validados, que permiten la identificación de todos los enterovirus (coxsackievirus, echovirus, poliovirus) y rinovirus (15). Se utilizó el sistema FastStart taq DNA polymerase (Roche Diagnostics®, Alemania). Las condiciones del PCR fueron desnaturalización inicial de tres minutos a 96 °C, 45 ciclos de 45 segundos a 94 °C, 45 segundos a 50 °C, 45 segundos a 72 °C y una extensión final de siete minutos a 72 °C.

ANÁLISIS DE DATOS

Las información obtenida se registró en una base de datos del programa Excel 2007. Para el análisis, los pacientes se clasificaron según la edad como lactantes (1 a 24 meses), preescolares (2 a 5 años) y escolares (6 a 14 años). El análisis de los datos se realizó con el programa estadístico STATA versión 11.0. Para las variables discretas y nominales se utilizó la prueba de chi cuadrado de Pearson con la corrección de Yates cuando fue necesario. Para las variables continuas de distribución normal se presenta las medias y desviaciones estándares (SD) y se utilizó la prueba t de Student. Para las variables continuas de distribución no normal se presenta las medianas y los rangos intercuartiles (RIQ) y se aplicó la prueba de suma de rangos de Wilcoxon. Se consideró significativo un valor p menor de 0,05.

ASPECTOS ÉTICOS

El estudio fue aprobado por los comités de ética en investigación del Hospital Nacional Cayetano Heredia, de la Universidad Peruana Cayetano Heredia y del Instituto Nacional de Salud. Los pacientes fueron enrolados previa firma del consentimiento informado por los padres y el asentimiento informado en los pacientes mayores de 8 años sin encefalopatía severa. Las fichas de recolección de datos, los consentimientos y asentimientos informados, así como las bases de datos informáticas están archivadas en el Servicio de Neurología Pediátrica del HNCH.

RESULTADOS

Durante el período del estudio se hospitalizaron en el HNCH a 112 niños con infecciones agudas del SNC. De estos, cinco pacientes tuvieron punciones lumbares frustras o traumáticas, siete pacientes tuvieron diagnóstico de meningoencefalitis bacteriana aguda, dos pacientes tuvieron ventriculitis por infección de sistema de derivación ventrículo peritoneal y un paciente que no ingresó al estudio tuvo un resultado positivo para VHS en un laboratorio particular. Finalmente, ingresaron al estudio 97 pacientes que cumplieron con los criterios de selección de infecciones agudas no bacterianas del SNC. De ellos, 59 fueron de sexo masculino (60,8 %). El 29,9 % procedían del distrito de San Martín de Porres de Lima.

La edad mediana (RIQ) fue 21,7 (11,3-68,6) meses. El grupo etario más frecuente fue el de los lactantes con 51 pacientes (52,6 % del total), seguido de los preescolares con 25 pacientes (25,8 %) y, finalmente, los escolares con 21 pacientes (21,7 %).

Según el tipo de infección aguda, hubo 67 casos de encefalitis aguda (69 %) y 30 casos de meningitis aguda (31 %). Ningún caso fue positivo para HSV-1, HSV-2 y VZV. Del total de pacientes, 51 (52,6 %) resultaron positivos para enterovirus. Hubo diferencias en cuanto al rol de los enterovirus como causa de las meningitis y encefalitis agudas. En el caso de las encefalitis el 38,8 % fueron positivas para enterovirus (26 pacientes), mientras que en el caso de las meningitis 83,3 % fueron positivas para enterovirus. Esta diferencia fue significativa con un p<0,001. Las frecuencias por edad, de infección aguda del SNC por enterovirus se muestran en la Figura 1.

 

Durante el periodo del estudio se observó una distribución estacional de las infecciones por enterovirus. En los meses cálidos, de noviembre a enero, los enterovirus fueron responsables del 82,9 % de todas las infecciones agudas del SNC, mientras que en los meses fríos, de mayo a julio, las infecciones por enterovirus fueron responsables solo del 28,6 % de las infecciones agudas del SNC, como se ve en la Figura 2.

En las barras se describe el total de infecciones agudas del SNC no bacterianas, entre abril de 2008 a marzo de 2010.

 

En el caso de las infecciones causadas por enterovirus el 58,8 % ocurrieron en lactantes, como se ve en la Tabla 1. No hubo diferencia significativa entre las medianas de las edades para los pacientes con infecciones ocasionadas o no ocasionadas por enterovirus (p=0,76). Tampoco hubo diferencia entre las medianas de las edades según tipo de infección (p=0,35).

 

El tiempo de enfermedad tuvo una mediana de tres días (RIQ: 2-4) en los casos de encefalitis y una mediana de cuatro días (RIQ: 3-6) en los pacientes con meningitis. No hubo diferencia significativa en el tiempo de enfermedad según tipo de infección o etiología. La duración promedio de los síntomas neurológicos fue de 25,4 ± 26,7 horas en los pacientes con encefalitis y de 47,1 ± 37,9 horas en el caso de las meningitis (p = 0,007). En la evaluación de la etiología con respecto al tiempo de enfermedad, las infecciones por enterovirus tuvieron mayor duración de síntomas neurológicos que las infecciones por otros agentes pero esta diferencia no fue significativa.

 

En cuanto a las características clínicas, tanto las encefalitis como las meningitis presentaron como síntomas principales comunes la fiebre, la somnolencia, la irritabilidad y los vómitos (Tabla 2). Las crisis convulsivas fueron un síntoma frecuente en los pacientes con encefalitis (62,7 %) mientras que en los pacientes con meningitis su frecuencia fue menor (46,7 %; p = 0,183). Entre los principales signos, la fiebre, la irritabilidad y la hiperreflexia estuvieron en ambos tipos de infecciones. La rigidez de nuca fue más frecuente en los casos de meningitis aguda (43,3 %) y menos en los casos de encefalitis (6,0 %) siendo esta diferencia significativa (p < 0,001). La tos fue más frecuente en las infecciones no producidas por enterovirus mientras que el compromiso de conciencia como signo clínico fue más frecuente en los pacientes con encefalitis por enterovirus. La temperatura promedio al momento del ingreso fue de 37,7 ± 1,0 °C y no hubo diferencia en cuanto al tipo de infección o la etiología.

En la punción lumbar, tanto en las encefalitis como en las meningitis se observó un incremento de la presión intracraneal, la presión de apertura media fue de 20,4 ± 8,8 cm H2O y no hubo diferencias según el tipo de infección o según la etiología ocasionada por enterovirus u otros agentes.

En cuanto a los análisis citológicos y bioquímicos del líquido cefalorraquídeo, la mediana (RIQ) del recuento leucocitario para las encefalitis fue de 0 (0-2) cel/mm3 y para las meningitis fue de 83,5 (34-200) cel/mm3 (p < 0,001). En cuanto al tipo leucocitario, los mononucleares tuvieron un porcentaje promedio para las encefalitis de 91,5 ± 22,6 % y 67,7 ± 24,4 % para las meningitis (p <0,001). No hubo diferencia en el recuento leucocitario ni tampoco en el tipo de leucocitos predo-minantes en las meningitis o encefalitis producidas por enterovirus u otros agentes.

En cuanto a la glucosa en LCR, las encefalitis tuvieron una concentración media de 58,0 ± 17,9 mg/dL y las meningitis tuvieron 53,4 ± 13,1 mg/dL, siendo estos valores estadísticamente similares. Sin embargo, cuando se analizó los niveles de glucosa para las infecciones ocasionadas por enterovirus y las no ocasionadas por dichos agentes, se encontró que las encefalitis por enterovirus tuvieron una concentración de glucosa en LCR de 52,8 ± 11,9 mg/dL mientras que las encefalitis no ocasionadas por enterovirus tuvieron 61,2 ± 20,3 mg/dL, siendo esta diferencia significativa (p = 0,04). En el caso de las meningitis, no hubo diferencia en cuanto al nivel de glucosa en LCR de las infecciones por enterovirus o por otros agentes. En cuanto a la glucosa sérica, tampoco hubo diferencia entre los valores de glicemia según tipo de infección o etiología.

Los niveles de proteínas en LCR para las meningitis tuvieron un valor mediano de 45,5 mg/dL (RIQ: 32-65 mg/dL). Estos valores fueron significativamente mayores a los de las encefalitis que tuvieron una mediana de 24 mg/dL (RIQ: 16-36 mg/dL; p <0,001). Las encefalitis y las meningitis ocasionadas por enterovirus, tuvieron valores de proteínas similares a las infecciones no ocasionadas por enterovirus.

 

DISCUSIÓN

En la presente investigación se demostró la infección por enterovirus en el 83,3 % de las meningitis agudas asépticas y en el 38,8 % de las encefalitis agudas. De manera global, se identificó a enterovirus en el 52,6 % del total de infecciones agudas no bacterianas del SNC. Este rol etiológico predominante es similar al descrito en estudios realizados en otras partes del mundo. En los Estados Unidos, por ejemplo, se informa que los enterovirus ocasionan entre el 75 y 95 % de todos los casos de meningitis agudas (16-18). Por otro lado, en España, en una serie hospitalaria de casos que acudieron con sospecha de infección del SNC, los enterovirus fueron responsables del 62,7 % de los casos de meningitis aséptica (2).

Los informes de otros países latinoamericanos tienen resultados disímiles; por ejemplo, en Venezuela entre 1995 y 1997 se encontraron como causas más frecuentes de encefalitis al virus de encefalitis equina venezolana en 42 %, seguido de VHS en 33 % y el virus Epstein-Barr en 15 % pero no se realizó la búsqueda de enterovirus (19). En una serie hospitalaria de 22 pacientes con meningitis aguda realizada en Valparaiso, Chile entre 1997 y 1998, los enterovirus detectados por PCR o cultivos virales, fueron responsables del 95 % de las meningitis asépticas (6). En Argentina el programa de vigilancia pasiva de meningitis y encefalitis virales encontró, entre 1991 y 1998, a los enterovirus como responsables del 28,8 % de las meningitis agudas y del 3 % de las encefalitis (8). Estos porcentajes mucho menores pueden explicarse, en parte, por la naturaleza no sistemática del programa de vigilancia. Las diferencias entre los informes de distintos países pueden también deberse al uso de diferentes definiciones operacionales, serotipos investigados distintos, sensibilidad y especificidad de las pruebas utilizadas, primers y técnicas diferentes de PCR y, obviamente, a diferencias epidemiológicas reales originadas por la existencia de factores climáticos, microbiológicos y de coberturas de inmunización propios de cada país.

El Hospital Nacional Cayetano Heredia se encuentra en el distrito de San Martín de Porres, ubicado al norte de la ciudad de Lima. Su área de influencia comprende los distritos de San Juan de Lurigancho, Comas, Independencia, Rímac, Los Olivos, Puente Piedra y Carabayllo. Estos distritos están compuestos mayoritariamente de viviendas en área urbana y urbano-marginal de nivel socioeconomico medio y bajo (20). No conocemos si la prevalencia de enterovirus es la misma en otros niveles socioeconómicos de Lima o del resto del país; sin embargo, creemos que debe ser similar, sobre todo en su distribución estacional.

Existen dos patrones de presentación epidemiológica de las infecciones virales agudas del SNC. El primero corresponde a los virus que se presentan en forma esporádica durante todos el año, como por ejemplo los herpesvirus; el segundo corresponde a los virus que se presentan en forma epidémica con un aumento del número de casos durante determinada época del año. Las infecciones agudas del SNC por enterovirus siguen este último patrón epidémico (21). Si bien son necesarios estudios multicéntricos y más prolongados para establecer el verdadero canal endémico de las infecciones por enterovirus, se ha observado en nuestro estudio una clara estacionalidad de las meningitis y encefalitis por estos agentes. Este patrón epidémico durante los meses cálidos es bien conocido y puede verse en los informes de otros países (8,16-18,22). Es probable que el predominio de infecciones distintas a enterovirus en los meses fríos del año se deba a virus respiratorios como ocurre en otros países (21,22) pero es necesario realizar investigaciones etiológicas al respecto.

En cuanto a la presentación clínica, es importante resaltar que los síntomas y signos de los pacientes con meningitis o encefalitis agudas por enterovirus no permiten diferenciarlos de los pacientes con infecciones por otros virus e incluso por bacterias. La clínica puede servir para establecer el diagnóstico de meningitis y encefalitis agudas pero no para precisar la etiología. En nuestra serie, en el caso de las encefalitis, las convulsiones fueron un signo clave para su diagnóstico, mientras que en el caso de las meningitis fue muy frecuente encontrar rigidez de nuca (43,3 %) en un porcentaje similar al descrito para las meningoencefalitis bacterianas (23). Estos datos son congruentes con la fisiopatología y son parte de la semiología clásica de estas entidades. En cuanto a la sintomatología específica, según etiología, la mayor frecuencia de tos en las infecciones no ocasionadas por enterovirus podría indicar una participación importante de los virus respiratorios en este grupo. La somnolencia, frecuente en las infecciones agudas del SNC y específicamente en las encefalitis por enterovirus, podría explicarse por la afección más difusa que ocasionan estos agentes en el encéfalo (21).

Las manifestaciones clínicas de las infecciones neurológicas por enterovirus son al inicio inespecíficas y consisten en cefalea, fiebre y posteriormente náuseas y vómitos. En estadios avanzados de la enfermedad se agregan somnolencia, ataxia y signos piramidales. Si bien ninguno de los pacientes del estudio falleció, en casos graves el compromiso de conciencia progresa hasta el coma y se puede presentar afección de nervios craneales y deterioro del patrón respiratorio por lesión de tronco encefálico, pudiendo ocurrir la muerte (21).

El estudio de LCR tampoco mostró particularidades para las infecciones producidas por enterovirus, excepto por los valores de glucosa en el LCR de los pacientes con encefalitis aguda que fue significativamente menor que el de pacientes con encefalitis no producidas por enterovirus, a pesar de valores similares de glicemia. Si bien la hipoglicorraquia y el predominio de polimorfonucleares son frecuentes en las encefalitis y meningitis por enterovirus, estas características son inespecíficas y no permiten establecer con certeza un determinado agente etiológico (21). En cuanto a los métodos diagnósticos, la serología y sobre todo la elevación en cuatro veces de los títulos de anticuerpos para enterovirus, tampoco ayudan en el momento de la atención inicial del paciente con una infección aguda del SNC. Las pruebas de PCR en LCR para la detección de enterovirus y herpesvirus resultan positivas desde los primeros días de la infección por estos agentes y tienen elevada sensibilidad (86 - 100 %) y especificidad (92 - 100 %) (24). Por este motivo, esta técnica se ha convertido en el método de elección para la detección de enterovirus y herpesvirus en los pacientes con infecciones agudas del SNC. La técnica de PCR múltiple para todos los enterovirus de importancia en humanos favorece su realización. Si bien es una técnica costosa, este disminuye cuando se analizan varias muestras simultáneas por lo que sería importante el establecimiento de un programa local de vigilancia sistemática de las meningitis y encefalitis por enterovirus que permita identificar rápidamente a los enterovirus como los causantes de enfermedad para así disminuir los costos y riesgos asociados al uso innecesario de antibióticos o aciclovir (21).

Este estudio tiene algunas limitaciones, en primer lugar, el número de muestras no fue lo suficientemente grande para poder definir con mayor precisión la prevalencia de enterovirus por grupo de edad y forma clínica. Sin embargo, es el primer estudio a nivel nacional que determina la prevalencia global de estos patógenos en las encefalitis y meningitis asépticas en pediatría. En segundo lugar, no se realizaron técnicas de PCR adicionales para determinar el tipo específico de enterovirus, ya que solo se determinó la familia utilizando el PCR “pan-enterovirus”. En tercer lugar, aunque no fue un objetivo del estudio, hubiera sido interesante determinar las otras etiologías virales en las muestras estudiadas (virus respiratorios, virus Epstein- Barr, citomegalovirus, arbovirus, etc).

En conclusión, los enterovirus son los principales agentes etiológicos de las meningitis agudas asépticas (83,3 %) y una de las principales causas de encefalitis (38,8 %) en pacientes pediátricos en Lima. A nivel local, los enterovirus tienen un comportamiento estacional con un claro aumento del número de casos en los meses cálidos (de noviembre a enero). En base a este estudio y por la alta prevalencia de este patógeno, se recomienda establecer un sistema de vigilancia local permanente que sirva de herramienta útil para la toma de decisiones al momento de abordar un paciente con sospecha de infección aguda del SNC.

AGRADECIMIENTOS

Agradecemos al personal médico del Servicio de Emergencia Pediátrica del HNCH que colaboró en la ejecución de este estudio, al INS por las sugerencias en el desarrollo del estudio y manuscrito y a los padres y pacientes por su valiosa participación.

Contribuciones de autoría

IOE, TJO, DG y RH participaron en la concepción y diseño del trabajo, obtención de resultados, análisis de datos, redacción y revisión crítica del manuscrito, y aprobación de su versión final. TJO realizó además la asesoría administrativa, y RH en la asesoría estadística. SM, FB y CU participaron de la obtención de resultados, redacción del manuscrito, y aprobación de su versión final. MPM y MLS participaron en la recolección de datos, revisión crítica del manuscrito, aprobación de su versión final, y facilitaron la coordinación para el acceso a las historias clínicas de los pacientes.

Fuentes de financiamiento

Este estudio fue financiado por el Instituto Nacional de Salud (INS) a través del VIII Concurso Nacional de Proyectos de Investigación con Impacto en Salud Pública del Perú, 2007; otorgado al Dr. Iván Espinoza.

Conflictos de interés

Los autores declaran no tener conflictos de interés.

 

REFERENCIAS BIBLIOGRÁFICAS

1. Losh DP. Central Nervous System Infections. Clinics in Family Practice. 2004;6(1):1-17.         [ Links ]  

2. Mintegui S, Sánchez J, Benito J, Vásquez M, Rubio G, Capapé S, et al. Tratamiento extrahospitalario de los niños con meningitis viral. An Pediatr (Barcelona). 2000;52(5):430-34.         [ Links ]  

3. Beaman MH, Wesselingh SL. Acute community-acquired meningitis and encephalitis. Med J Aust. 2002;176(8):389-96.         [ Links ]  

4. Adams WG, Deaver KA, Cochi SL, Plikaytis BD, Zell ER, Broome CV, et al. Decline of childhood Haemophilus influenzae type b (Hib) disease in the Hib vaccine era. JAMA. 1993;269(2):221-6.         [ Links ]  

5. Whitney CG, Farley MM, Hadler J, Harrison LH, Bennett NM, Lynfield R, et al. Decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine. N Engl J Med. 2003;348(18):1737-46.         [ Links ]  

6. Soler CHM, Vergara FR, Silva VM, Collao FX, Navarrete BE. Detección de enterovirus mediante transcripción reversa y reacción de polimerasa en cadena en líquido cefalorraquídeo de niños con meningitis aséptica. Rev Chil Infect. 2001;18(3):175-81.         [ Links ]  

7. Romero J, Newland J. Viral Meningitis and Encephalitis: Traditional and Emerging Viral Agents. Semin Pediatr Infect Dis. 2003;14(2):72-82.         [ Links ]  

8. Cisterna DM, Palacios G, Rivero K, Girard D, Lema C, Freire MC. Epidemiología de los enterovirus asociados a enfermedades neurológicas. Medicina (Buenos Aires). 2007;67(2):113-9.         [ Links ]  

9. Whitley RJ, Kimberlin DW. Viral encephalitis. Pediatr Rev. 1999;20(6):192-8.         [ Links ]  

10. Chaudhuri A, Kennedy PG. Diagnosis and treatment of viral encephalitis. Postgrad Med J. 2002;78(924):575-83.         [ Links ]  

11. Steiner I, Budka H, Chaudhuri A, Koskiniemi M, Sainio K, Salonen O, et al. Viral encephalitis: a review of diagnostic methods and guidelines for management. Eur J Neurol. 2005;12(5):331-43.         [ Links ]  

12. Thomson RB Jr, Bertram H. Laboratory diagnosis of central nervous system infections. Infect Dis Clin North Am. 2001;15(4):1047-71.         [ Links ]  

13. Boos J, Esiri MM. Diagnostic evaluation. In: Boos J, Esiri MM (editors). Viral encephalitis in humans. Washington, DC: ASM Press; 2003. p. 21-30.         [ Links ]  

14. Kolski H, Ford-Jones EL, Richardson S, Petric M, Nelson S, Jamieson F, et al. Etiology of acute childhood encephalitis at The Hospital for Sick Children, Toronto, 1994-1995. Clin Infect Dis. 1998;26(2):398-409.         [ Links ]  

15. Kares S, Lonnrot M, Vuorinen P, Oikarinen S, Taurianen S, Hyoty H. Real-time PCR for rapid diagnosis of entero - and rhinovirus infections using LightCycler. J Clin Virol. 2004;29(2):99-104.         [ Links ]  

16. Centers for Disease Control and Prevention (CDC). Summary of notifiable diseases, United States, 1993. MMWR Morb Mortal Wkly Rep. 1994;42(53):22.         [ Links ]  

17. Khetsuriani N, Lamonte-Fowlkes A, Oberst S, Pallansch MA. Enterovirus surveillance--United States, 1970-2005. MMWR Surveill Summ. 2006;55(8):1-20.         [ Links ]  

18. Centers for Disease Control and Prevention (CDC). Enterovirus surveillance--United States, 2002-2004. MMWR Morb Mortal Wkly Rep. 2006;55(6):153-6.         [ Links ]  

19. Valero N, Henriquez R, Hernandez C, Pomeda O, Romero M, Urdaneta F, et al. Agentes virales en pacientes con procesos infecciosos del sistema nervioso central. Invest Clin. 2001;42(4):255-67.         [ Links ]  

20. Instituto Nacional de Estadística e Informática. Censos Nacionales 2007: XI de Población y VI de Vivienda. Sistema de Consulta de Cuadros Estadísticos [página de internet]. Lima: INEI; 2007. [Fecha de acceso: 28 de setiembre del 2011]; Disponible en: http://desa.inei.gob.pe/censos2007/tabulados/.         [ Links ]

21. Boos J, Esiri MM. Influenza virus, enteroviruses, and other epidemic viruses. In: Boos J, Esiri MM (editors). Viral encephalitis in humans. Washington, DC: ASM Press; 2003. p. 143-62.         [ Links ]  

22. Koskiniemi M, Korppi M, Mustonen K, Rantala H, Muttilainen M, Herrgard E, et al. Epidemiology of encephalitis in children. A prospective multicentre study. Eur J Pediatr. 1997;156(7):541-5.         [ Links ]  

23. Gustin R. Meningitis bacterianas en niños. Instituto de Salud del Niño, Lima-Perú, 1997-2002. Paediatrica. 2005;7(1):12-7.         [ Links ]  

24. Romero JR. Reverse-transcription polymerase chain reaction detection of the enteroviruses. Arch Pathol Lab Med. 1999;123(12):1161-9.         [ Links ]  

 

Correspondencia:

Iván Espinoza

Dirección: Av. Honorio Delgado N.° 262, Urbanización Ingeniería. San Martín de Porres, Lima 33, Perú.

Teléfono: (511) 01-4820402.

Correo electrónico: ivespinoza@gmail.com.

 

Recibido: 14-07-11

Aprobado: 26-10-11